Очищающий гель для комбинированной и жирной кожи / Antistress - Cleansing gel

Бренд: Norel
Номер: DZ 249
3 000руб

Деликатный гель предназначен для ухода за нормальной и комбинированной кожей, а также чувствительной и склонной к раздражению

Описание

Линия: Antistress

Объём: 200 мл

Описание

Деликатный гель предназначен для ухода за нормальной и комбинированной кожей, а также чувствительной и склонной к раздражению

Активные ингредиенты:

Sepicontrol TM A5, экстракт корня солодки и астрагала, пантенол. 

Действие:

  • бережно и эффективно удаляет загрязнения, макияж, остатки и излишки кожного сала;
  • нормализует функции сальных желез и контролирует жирность;
  • не пересушивает эпидермис;
  • оставляет кожу чистой, гладкой и свежей.

Способ применения:

утром и вечером нанесите небольшое количество геля на влажную кожу лица и шеи, а затем тщательно массируйте до получения пены, смойте водой, высушите и нанесите тоник и крем из линии Antistress.

Отзывы покупателей
I felt like I wasn t allowed my condition buy accutane canada
Modification of the effect of tamoxifen, cis platin, DTIC, and interferon О±2b on human melanoma cells in culture by a mixture of vitamins kamagra interactions
Next, chromatin immunoprecipitation ChIP enriched DNA was amplified using PCR, and the primer sets were designed as follows Beclin1 5 GGTCAGCGAGACCCTTGGAA 3 sense and 5 AGAATTATATCACCAAAGCTGCCC 3 anti sense clomid from canada
Renal Scans side effects of doxycycline hyclate
Написать отзыв
Имя
E-mail
Отзыв
Рейтинг